E5D5 A5 getar jiwa kuungkapkan ke dalam nada C5 D5 E5 ooh.. tercipta lagu E5 D5 A5 Kutuliskan kata hati ke dalam bait C5 D5 E5 ooh..tercipta lirik G5 A5 D5 C5 D5 A5 dan nada sendu G5 A5 D5 C5 B5 E5 Curahan desah kalbu di kala itu E5 D5 A5 Pada gitar kupetikkan nada indah C5 D5 E5 ooh..damai di hati E5 D5 A5 Dan kutuangkan
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose AAAAAAFAAAAGAAACAAAAAAAGAAAAAAAACAAAAAAAAFAAACAAAAAAAAAAAAADmAAAAGAAAAAAAAAAAAAFAAACAAAAAAAAAGAAAACAAAAAAAAAAAAAAAAAAFAAAGCAAAAAAAAAAAAADmAAAAGAAACAAAAAAAAAFAAACAAAAAAAAAGAACAAAAAAAAAGAAAAAAAAACAAAAAAAAAFAAACAAAAAAAAAAAAAADmAAAGAAAAAAACAAAAAAFAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAFAAAACAAAAAAAAAAAAADmAAAGAAAACAAAAAAAAFAAAACAAAAAAAAAGAFCAAAAAAAAAAAAAAAAGFAAAACAAAAAAAAAAAADmAACAGAAACAAAAAAAAFAAACAAAAAAAAGAAAACAAAAAAAAAAAAAAGAAFAAAAAAAAAAAAAAAN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
TempatAsyik Cari Chord Gitar. Home; Facebook; Twitter; Boomerang - Kisah. Intro : G Em C D G Ku ingin kau mengerti Em Betapa ku merindukan C Saat - saat yang indah Nyanyi bocah-bocah di kala purnama A Bm E Nyanyikan pujaan untuk nusa [**] A D Damai saudaraku suburlah bumiku A E
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNNENNNNDNNNNNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNNANNNNNDNNNNNNANNNNNDNNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNBmNNNNNNENNNNNNANNNNNDNNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNANNNNNNDNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNNDNNNNNNNNNNBmNNNNNNNENNNNNANNNNNNDNNNNNNNNNNNNGNNNNNNNDNNNNNNNNNNNNANNNNNDNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNNDNNNNNNNNNNANNNNNNNDNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNNDNNNNNNNNNNNNBmNNNNNENNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNANNNNNNNDNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNNNBmNNNNENNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNANNNNNNDNNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNBmNNNNNNENNNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNANNNNNNDNNNNNNNNNNNNNNNNNNNNANNNNNDNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
JANGANENGKAU CEMBURU Jangan engkau cemburu kau keliru kalau begitu karena aku hanya teman biasa. Aku tidak mengerti kau berubah jadi pembenci, Tapi aku mengkaharapkanmu mengerti. @ Dulu pernahku katakan jangan selalu cembUru, karena kau telah tahu hatiku. Jangan engakau mengira, aku berbuat semaunya, Karena aku tetap menjadi milikkmu. #Musik# @ SEMUA SAMA Oh mama, engkau wanita yang mulia Oh
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNDNNNNNNNNNANNNNNDNNNNNNANNNNNNNNNNNNDNNNNNGNNNNNNNNNNDNNNNNNNBmNNNNNNENNNNNANNNNNNDNNNNNNNNNNNGNNNNNNDNNNNNNNNNNANNNNNNNDNNNNNNNNNNANNNNNNNDNNNNNNGNNNNNNNNANNNNNNNNNBmNNNNNNENNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNNANNNNNDNNNNNANNNNNNDNNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNBmNNNNNENNNNNNANNNNNDNNNNNNNNNNNNGNNNNNNDNNNNNNNNNNNNNANNNNDNNNNNNNNNNNNNNNNNNNNNNNNNGNNNNNNNANNNNNNNNNNBmNNNNNENNNNNNANNNNNDNNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNNNENNNNDNNNNNNNBNNNNENNNNNNNNNNNANNNNNNENNNNNNNNNNNNNNNNNNNNFNNNNNNNNNNENNNNNNNNNNNNANNNNNENNNNNNNNNNNNNNNNNNNNNNNNNNBNNNNENNNNNNNNNNNNNNNNNNNNNNNNBNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
ChordGitar dan Lirik Lagu Kala Cinta Menggoda - Chrisye: Maka Maafkan Jika Ku Mencintaimu Berikut ini Chord Kala Cinta Menggoda - Chrisye, Kunci Gitar Mudah dari Am. Minggu, 27 Maret 2022 15:36 WIB
album Simplified info_outline Major & minor chords only visibility 123 album Advanced info_outline Includes 6,7,aug,hdim7 chords visibility 123 album Bass info_outline Advance chords for bass visibility 123 album Edited info_outline All Edited versions visibility 123 album Chords Notes info_outline Notes in chords visibility 123 album Simple Notes info_outline Rhythm of the song visibility 123 album Bass Notes info_outline Sheet music of bass visibility 123 album Music Notes info_outline Sequence of instrument notes visibility 123 close aspect_ratio arrow_drop_down Show all diagrams layers Edit Lyrics cloud_done Save cancel Cancel Edit delete_forever Delete this Version 3/4Time Signature arrow_back0SHIFT arrow_forward BPM doneclose NNNNCNNNNNNNDNNNNNNNNNAmNNNNNGNNNNNNNNNNNDNNNNNANNNNNDNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNBmNNNNNENNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNANNNNNDNNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNNNNNNENNNNNANNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNANNNNNDNNNNNANNNNNDNNNNNCNNNNNGNNNNNNNNNNNDNNNNANNNNNDNNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNNNNNNENNNNNANNNNNDNNNNNNNNNNGNNNNNDNNNNNNNNNNNANNNNNDNNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNNNNNNENNNNNANNNNNDNNNNNNNNNNNGNNNNNDNNNNNNNNNNNANNNNNDNNNNNANNNNNDNNNNANNNNNGNNNNNNNGmNNNNNNNNNNNNNNNNNNNNNN Private lock Publiclanguage file_download PDF & Tabs music_note Download Midi clear ChordU Learn Any Instrument ChordU has always been about simplicity and ease of access. We are constantly improving our accuracy through research and development. We hope you have a wonderful experience with us. Hello Again !! Please login to your ChordU account. mail Login with Email Forgot Password? Don't have an account? Sign Up trending_flat clearsecurity Forgot Password No worries, enter your registered email to reset your password keyboard_backspace Back to Login
CHORDGUITAR AND LYRICS at 05:28 No comments: Hanya ingat Kamu kala duka ku Dm F Namun hanya Kamu yang mampu membuka Dm E Pintu hatinya tuk cintaku Gingerbread - Kau Ku Rindukan; Gingerbread - Ku Cari Damai Dihati; Gersang - Bersama Suara Hati; Gersang - Suratan Takdir; Freddie Aguilar - Anak;
Kala ku cari damai Kala ku cari damai hanya kudapat dalam Yesus Kala ku cari ketenangan hanya kutemui di dalam Yesus Tak satupun dapat menghiburku Tak seorangpun dapat menolongku Hanya Yesus jawaban Hidupku Bersama Dia hatiku damai walau dalam lembah kekelaman Bersama Dia hatiku tenang walau hidup penuh tantangan Tak satupun dapat menghiburku Tak seorangpun dapat menolongku Hanya Yesus jawaban Hidupku
. 187 56 202 382 348 82 122 48
chord kala ku cari damai
